McDonald’s has announced that even though the FDA approved a new genetically modified potato called the Innate potato, which has DNA that has been altered so it doesn’t naturally produce cancer-causing chemicals when cooked at high temperatures, the company will not use them for french fries. What do you think?

“Good call. Everyone knows a french fry’s flavor comes from its unmodified ACTGCGCATCTTGCAATATCGAGCA DNA sequence.”
Carol Clement • Rope Course Designer

“When will these scientists stop playing God and just let food give us cancer?”
Donald Lappin • Lampshade Collector
Advertisement

“At least we know they use potatoes.”
John Krieger • Unemployed